تبلیغات
قناری - مطالب خرداد 1389
جمعه 14 خرداد 1389  08:52 ق.ظ    ویرایش: پنجشنبه 28 مهر 1390 11:02 ق.ظ
توسط: m m

سلام. یکی از چیزهایی برای پرورش دهندگان قناری لذت بخشه، تولید مثل و جوجه دار شدن قناریهاست. این تجربه رو کسانی که از قناریها جوجه گرفتن دارن. وقتی جوجه سر از تخم در میاره لحظه به یاد موندنی و زیباییه. به خاطر اینکه این لحظه رو تجربه کنید لازمه در نگهداری تخم ها به قناریها کمک کنید.

مطالبی که در این قسمت می خوام بنویسم راجع به نکاتیه که ممکنه جای دیگه کمتر خونده باشید. پس خوندن این قسمت خالی از لطف نیست.

1- تخم از زمانی که ماده روش می خوابه، تا زمان تبدیل شدنش به جوجه و خارج شدن جوجه از اون 14 روز طول می کشه. اگه قناری تخم اول رو مثلا روز اول ماه بذاره، جوجه روز پانزدهم به دنیا می یاد. از اونجایی که ماده هر روز یک تخم می ذاره، وقتی ماده تخمهای بعدی رو می ذاره، جوجه ها هم به همون اندازه دیرتر از اولی به دنیا می یان. حالا اگه ماده 3 یا 4 تخم بذاره، جوجه سوم و چهارم 3 و 4 روز دیرتر به دنیا می یان. ازطرف دیگه جوجه در روزهای اول خیلی زود رشد می کنه. وقتی جوجه چهارم به دنیا می یاد جوجه اول از لحاظ جثه چندین برابر اون هست. به همین خاطر معمولا جوجه های آخر زیر پای جوجه های اول له شده و از بین می ره. یا اینکه خوب تغذیه نمیشه. چون جوجه های بزرگتر اجازه نمی دن ماده غذا تو دهن کوچکترها بذارن.بهترین راه برای حل این مشکل اینه که تخم ها رو برداشته و یکجا زیر پای ماده بذارین.

در زمانی که اقدام به برداشتن تخم ها می کنید، خیلی باید دقت کنید که تخم نشکنه. چون پوست اون خیلی نازکه. باید چال رو از قفس در آورده، به آرامی تخم را برداشته و اون رو در ظرفی حاوی دانه های ریز و نرم مثه دون کاهو بذارین. درب اون رو بسته و در محلی کم نور با دمای همسطح اتاق قرار بدین. ظرف نباید تکان خورده و تخم ها به هم اصابت کنن. چون به مجرد برخورد هر چیزی به تخم ها شکسته یا ترک برداشته می شن.اونوقته که دیگه تخم خراب شده و از بین می ره.

وقتی تخم رو بر می دارین بهتره چیزی جاش بذارین. مثلا تخم پوک یا تخم مصنوعی که در بازار وجود داره و می تونید بخرید. اما یادتون باشه تخم های پوک رو علامت بزنید تا با تخم ماده اشتباه گرفته نشه.

بعد از اینکه ماده آخرین تخم رو گذاشت همه تخم ها رو یکجا زیر پای ماده می ذارین.البته این کار رو می تونین از تخم چهارم انجام بدین. چون معمولا تخم های بعدی پوک هستن.

2- زمانی که ماده روی تخم ها خوابیده از ایجاد صداهای ناهنجار و ترسناک و نیز حرکت دادن قفس جلوگیری کنید. چرا که یکی از عوامل مرگ و میر جوجه ها در تخم صدای شدید و ترسه.

3- قفس پشت پنجره و امثال این محل ها نباشه. چرا که نور شدید آفتاب برای ماده و تخم ها ضرر داره.

4- در ایامی که هوا بارونیه، رعد و برق به تخم آسیب می رسونه جایی قفس رو نذارین که در معرض برق باشه( مثه پشت پنجره)

5- کنجکاوی شما باعث نشه که دم به ساعت سراغ ماده برید و اون رو از روی تخم ها بردارین یا هی تو قفس سرک بکشین. این کار باعث می شه ماده خوب روی تخم ها نخوابه و همین عامل باعث سرما خوردن به تخم و مرگ جوجه می شه. همین که دورادور مراقبت می کنید که یه وقتی تخم از چال بیرون نمونه یا اینکه با پای قناری کنار چال قرار نگیره کافیه.

6- قبل اینکه ماده رو جفت کنید ناخن های اون رو کوتاه کنید. بلندی ناخن ها باعث می شه وقتی از روی تخم برای خوردن غذا بلند می شه تخم به پاش و ناخنش برخورد کرده و از چال بیرون بیفته. معمولا وقتی تخم از تو چال در می یاد ماده اون رو سرجاش نمی ذاره.

7- بهتره از چال های استاندارد که دارای منافذ هست استفاده کنید. لازمه هوا در چال در جریان باشه. چال قناری محل مناسبی برای شپش هست. جریان هوا تا حدودی مانع از اجتماع حشرات موذی خواهد شد. چال کاملا تمیز باشه و پنبه ها هم کاملا تمیز.یک چال رو برای دوبار تخم گذاری استفاده نکنید. خوبه دیواره چال رو آغشته به پودر ضد شپش کرده و بعد پنبه ها رو به اون بچسبانید.

8- برای اینکه پنبه ها از توی چال بیرون ریخته نشه اونها رو به دیواره چال با چسب مایع بچسبانید.

9- هر قدر جثه قناری شما بزرگتر باشه چال هم باید بزرگتر باشه. این نکته در مورد قناری پرستار که تخم قناریهای درشت رو( مثه یورک و...)نگهداری میکنه لازمه رعایت بشه. چون جوجه ها وقتی بزرگ می شن جاشون توی چال بشه.

10- هر 3 روز یکبار به قناری که تخم داره، تخم مرغ بدین. متاسفانه برخی از قناریها تخم های خودشون رو می خورن. برای جلوگیری از این مسئله بهتره بهشون تخم مرغ بدین

   


نظرات()   
جمعه 14 خرداد 1389  08:21 ق.ظ    ویرایش: پنجشنبه 28 مهر 1390 11:02 ق.ظ
توسط: m m
نوع مطلب: دارو ها ،

Seri Sept جهت  درمان قارچ و جراحات پرنده
Serie پودر تقویت نطفه پرنده
Tetraseptol مایع ضد عفونی کننده قدرتمند جهت قفس و پرنده
Insectronis پودر نابود کننده شپش و کنه قناری
Calciolin درمان کننده بیماریهای کبد
Seri Pox درمان کننده زخم آبله داخلی و خارجی
غذای قناری شامل : غذای تخم مرغی + عسل + Cria
غذای قناری شامل : غذای تخم مرغی + عسل + Cria + رنگ قرمز
Vermicide داروی بر طرف كننده انگل پرندگان
Canto تشدید كننده حالت مستی در قناری
Muda دارویی مناسب برای دوران تولك قناری كه به پر سازی پرنده كمك میكند
Sulfa داروی برطرف كننده ورم روده
Anti Stress برطرف كننده استرس پرندگان مخصوصا برای زمانهای جابجایی
B-Complex محلول اشتها آور و تقویت كننده عمومی پرنده
Anti biotico درمان كننده اسهال سبز پرنده
Gentamacina برطرف كننده عفونت روده پرنده
Anti asmatico درمان كننده آسم پرنده
Calico محلول كلسیم برای پرنده مخصوص دوران تخم گذاری
AD3E تقویت كننده نطفه قناری
Total شامل كلیه ویتامین های مورد نیاز پرندگان زینتی
Pomade پماد بر طرف كننده شقاق پای پرندگان زینتی
Cria دان مخصوص جوجه قناری
Tabernil پودر ضد شپش و كنه قناری
Asmoserin داروی ضد آسم قناری
Biosserin داروی تركیبی ضد ورم روده
Seridon داروی تركیبی درمان ورم روده شدید در پرندگان
Seri Band محلول برطرف كننده و ضد ویروس خارجی
Nekton B-complex تقویت كننده عمومی شامل ویتامینها ی مورد نیاز، آرامبخش
Orlux (محصول بلژیك) پودر كلسیم
Ferivit Orlux (محصول بلژیك) تقویت كننده نطفه و ازدیاد تخم در قناری
Cantax orlux تقویت كننده رنگ قرمز
Colombin (محصول بلژیك) اسپری ضد شپش
Vita Form (محصول تركیه) ازدیاد كننده تخم در قناری
Avi Spray (محصول تركیه) اسپری ضد شپش
Opical 5 (محصول تركیه) پودر ضد شپش
Quiko goldy غذای بلبل
Quiko BEO غذای مینا
Quiko Parrot غذای كاسكو
غذای سرنگی Quiko غذای سرنگی
Quiko Med داروی مخصوص درمان كلیه ی  بیماریهای گوارشی در پرندگان
ًQuiko MED Aqua داروی درمان بیماریهای گوارشی
Quiko P تقویت كننده كبوتر
Bactazol ضد شپش و ضد عفونی كننده و از بین برنده باكتریهای مضر
Fort مكمل غذایی
Plus مكمل غذایی
Quiko E تقویت كننده نطفه
Quiko Special غذای تخم مرغی ویژه
Ardap اسپری از بین برنده شپش
Bioserine درمان كننده اسهال ، ورم روده و سرماخوردگی
Calci-lux تامین كننده كلسیم مورد نیاز بدن پرنده
Insectornis پودر ضد شپش قابل استفاده در زمان آب تنی پرنده
K-3 قابل استفاده برای درمان یبوست ، اسهال ، سرماخوردگی و بیماریهای روده
Lutricyline درمان بیماریهای تنفسی و تیفوس ، اسهال عفونی و مشكلات تناسلی
Nekton-M-S-A شامل مواد معدنی ، اسیدهای آمینه ، شلنیوم ، كلسیم و فسفات میباشد . مورد استفاده جهت شكل گیری و استحكام استخوانها و تقویت نطفه
Nekton-Tonik-I یك مكمل غذایی كه شامل تمامی مواد غذایی ضروری برای پرنده میباشد
Nekton-Bio ماده ای مقوی سرشار از پروتئین و 10 نوع ویتامین مهم و 6 نوع املاح معدنی
Nekton-E جهت تقویت نطفه قناری
Nekton-Q مكمل غذایی شامل ویتامین های K-E-A
Nekton-S سرشار از ویتامین ، اسید آمینه و سلنیوم جهت رشد
Quikon-forte سرشار از ویتامینهای E و آهن و تامین كننده تمام ویتامینهای مورد نیاز برای زمان جوجه كشی و رشد جوجه های جوان
Quikon-Spirulina تقویت كننده سیستم دفاعی بدن ، پر رنگ كردن رنگ پرها ، رفع ریزش پر ، تقویت جوجه ها
Quiko-Adec قابل استفاده برای زمانهایی كه قناری ضعیف شده است. تقویت كننده استخوانهای پرنده
Quikon-Bierhefe شامل ویتامینها و سفیده تخم مرغ ، موثر در افزایش توان جسمی و رشد بهتر جوجه ها
Quikon-Plus این ماده تقویت كننده قابل استفاده برای جوجه های یكروزه تا انتهای دوران تولك می باشد و باعث تقویت سیستم ایمنی بدن جوجه ها می شود.
Quikon-badesalz استفاده از این ماده باعث می شود كه زمان تولك كوتاه شده و گرد و غبار پرها نیز برطرف شود
Ropa-B استفاده از این ماده باعث می شود كه زمان تولك كوتاه شده و گرد و غبار پرها نیز برطرف شود
SERINOL جهت پیشگیری و معالجه پرنده در مقابل باكتری و ویروس
Terramycin این دارو به شكل پماد و محلول در آب می باشد و برای درمان عفونتهای چشمی و تسكین درد چشم ناشی از عفونت زخم قرنیه به كار میرود
Vitacombex-V

جهت درمان بیماریهای ناشی از كمبود ویتامین مانند نرمی استخوان و ضعف توان جنسی پرنده استفاده می شود

   


نظرات()   
جمعه 14 خرداد 1389  08:20 ق.ظ    ویرایش: پنجشنبه 28 مهر 1390 11:03 ق.ظ
توسط: m m
نوع مطلب: عمومی ،

چکیده:
تعیین جنسیت اغلب پرندگان تا زمان بلوغ و حتی گاهی بعد از بلوغ امری نسبتا مشکل است. اما جنسیت پرندگان و سایر جانوران از بدو تشکیل نطفه، به لحاظ ژنتیکی معین است. امروزه با پیشرفت روش های مولکولی، تعیین جنسیت جانداران در هر مرحله از زندگی میسر می باشد. در تحقیق حاظر تعیین جنسیت در قناری با استفاده از واکنش PCR و براساس دو ژن CHD-W و CHD-Z شرح داده شده است. در این تحقیق جمعا از 29 قطعه قناری استفاده شد. استخراج DNA از انتهای کالاموس پر قناری های زنده صورت پذیرفت و با استفاده از پرایمرهای اختصاصی طراحی شده در این طرح، واکنش PCR تنظیم گردید. نتایج نشان دهنده تکثیر دو قطعه DNA به طول های 345 و 306 جفت باز برای جنس ماده و فقط یک باند 306 جفت باز برای جنس نر بود. این نتایج برای کلیه نمونه های پر مشاهده شد. از آنجا که طراحی این سیستم تعیین جنسیت برای اولین بار در قناری مورد استفاده قرار می گیرد و نتایج مولکولی با ویژگی های مورفولوژیک دو جنس نر و ماده کاملا مطابقت دارد، لذا تعیین جنسیت جوجه های قناری با انجام واکنش PCR روی نمونه های پر، آسان، سریع، بی خطر و ارزان می باشد.
مقدمه:
قناری ها (Serinus canaria canaria) از جمله زیباترین پرندگان خانگی هستند که از زمان های بسیار دور نگهداری آنها به خاطر آواز دلنشین و رنگ آمیزی زیبایشان رایج شده و مورد توجه مردم سراسر دنیا قرار گرفته است. طبق دسته بندی سیستماتیک زیست شناسی، قناری وحشی به راسته گنجشک ها (Passeriformes) و به خانواده فنچ ها (Fringillidae) تعلق دارند. با توجه به اینکه قناری ها از زمان بلوغ شروع به آواز خواندن می کنند و صدای زیبای قناری ها بیشتر توسط جنس نر تولید می شود، به همین دلیل جنس نر این پرنده نسبت به جنس ماده از لحاظ اقتصادی دارای ارزش بیشتری است و با قیمت افزون تری نسبت به جنس ماده به فروش می رسد (1، 2و 3). یکی از بهترین راه ها برای تمایز دادن پرندگان نر و ماده استفاده از روشهای مولکولی بر اساس DNA است. یافتن یک نشانگر مولکولی مناسب برای تعیین جنسیت، کاری دشوار است. از آنجا که ژنوتیپ پرنده ماده ZW و ژنوتیپ پرنده نر ZZ می باشد، لذا کروموزوم W فقط در جنس ماده پرندگان وجود دارد و بر اساس آن می توان مارکر ژنتیکی مناسبی برای تفکیک جنس های نر و ماده از هم یافت. این ویژگی همانند کروموزوم Y در انسان است با این تفاوت که در انسان و سایر پستانداران، جنس نر هتروگامتیک است و جنس ماده هموگامتیک می باشد ولی در پرندگان وضعیت دقیقا عکس است (4و5). برخی از ژنهای موجود بر روی کروموزوم W بسیار حفظ شده بوده و با استفاده از این گونه ژن ها می توان در تمام گونه های پرندگان، جنسیت پرنده را با استفاده از یک جفت پرایمر و طی یک مرحله انجام واکنش PCR تعیین کرد (6). در برخی از پرندگان، نظیر پرندگان عظیم الجثه مانند شترمرغ، پرایمرهای مربوط به ژن CHD، سبب تکثیر قطعاتی در هر دو ژن CHD-W و CHD-Z می گردد زیرا این پرایمر ها همزمان با هم قسمت های هومولگ از ژن CHD-W و ژن مرتبط آن یعنی CHD-Z را تکثیر می نمایند اما در این قطعات تکثیر شده، تفاوت طول مشاهده می گردد و از همین خاصیت می توان به منظور تعیین جنسیت پرندگان بهره گرفت (7و8). هدف از این تحقیق تنظیم روش PCR برای تعیین جنسیت قناری برای اولین بار با پرایمرهای جدید طراحی شده می باشد.
مواد و روش کار:
به منظور تعیین جنسیت قناری جمعا از 29 قطعه قناری نمونه گیری به عمل آمد. نمونه گیری از انتهای کالاموس پر قناری های زنده (11 ماده و 6 نر و12 جوجه قناری با جنسیت نامعلوم) صورت گرفت و‌DNA ی ژنومی با استفاده از روش استاندارد فنل-کلروفرم استخراج گردید و جهت اطمینان از کیفیت DNA و مشاهده قطعات DNAی استخراج شده از ژل آگارز 1 درصد و رنگ آمیزی توسط اتیدیوم برماید استفاده شد، همچنین کیفیت DNA استخراج شده توسط دستگاه اسپکتروفوتومتر نیز بررسی گردید. به منظور انجام PCR، نیاز به پرایمرهای اختصاصی تعیین جنسیت می باشد که بر اساس ژن CHD قناری طراحی گردند. اما پس از انجام مطالعات بسیار، توالی ژن CHD قناری یافت نشد لذا به منظور طراحی پرایمر از توالی ژن CHD-W مربوط به پرنده ای با نام علمی Hemispingus frontalis که از خانواده Fringillidae می باشد و قرابت فیلوژنتیکی بالایی با Serinus canaria دارد، استفاده شد. توالی پرایمرهای طراحی شده برای این تحقیق به صورت زیر است:

Canary-F: 5'- GGATGAGGAACTGTGCAAAAC -3'

Canary-R: 5'- AATAGTTCGCGGTCTTCCAC -3'

برای انجام واکنش PCR حجم نهایی واکنش 25 میکرولیتر بوده که شامل: 20 نانوگرم DNA الگو، 2 میلی مولار MgCl2، 25 پیکومول از هر پرایمر، 1 واحد آنزیم DNA پلیمراز Taq و200 میکرو مولار dNTP Mix بود. برای انجام واکنش PCR از دستگاه مسترسایکلر گرادینت شرکت Eppendorf استفاده شد. برنامه ی حرارتی مورد استفاده شامل: 95 درجه سانتی گراد 5 دقیقه، سپس 30 چرخه دمایی به ترتیب 94 درجه سانتی گراد 1 دقیقه، 58 درجه سانتی گراد 1 دقیقه و 72 درجه سانتی گراد 1 دقیقه و یک مرحله نهایی 72 درجه سانتی گراد 5 دقیقه تنظیم گردید. سپس محصولات PCR با ژل آگارز 5/1 درصد الکتروفورز گردید و توسط اتیدیوم برماید رنگ آمیزی شد و با استفاده از نور UV مورد ارزیابی قرار گرفت.
نتایج و بحث:
از کالاموس پر پرندگان مورد آزمایش، DNAی ژنومی با موفقیت استخراج گردید و کیفیت DNA ی استخراج شده با استفاده از روش طیف سنجی و الکتروفورز روی ژل آگارز 1 درصد تعیین گردید. سپس غلظت DNA استخراج شده به میزان ng/μl 20 تنظیم شد. انجام PCR با پرایمرهای اختصاصی طراحی شده ی تعیین جنسیت در قناری و مشاهده ی نتایج حاصل بر روی ژل آگارز 5/1 درصد نشان دهنده تکثیر دو قطعه DNA به طول های 345 و 306 جفت باز برای جنس ماده و یک باند 306 جفت باز برای جنس نر بود که در ژل آگارز مشاهده می شود.
نتایج حاصل نشان می دهد، تعیین جنسیت قناری با استفاده از این روش، بسیار سریع، دقیق و کم هزینه بوده و در هر دوره از زندگی این پرنده می تواند بکار رود. از آنجایی که تعیین جنسیت پرندگان با استفاده از روش های قدیمی مانند لمس کلواک، سنجش میزان استروئید، کاریوتایپینگ و... دشوار و زمانبر می باشد و حتی در برخی موارد موجب مرگ پرنده می شود(9) لذا محققین متعددی تا کنون در راستای تعیین جنسیت مولکولی موجودات تلاش نموده اند و برخی نیز به نتایج مطلوبی دست یافته اند. برای مثال در سال 1998 Griffiths و همکاران با استفاده از دو ژن CHD-W و CHD-Z و طراحی پرایمر های متعدد، به تعیین جنسیت گروهی از پرندگان (شتر مرغ، قو، کبوتر، غاز وحشی و ...) پرداخته اند (10). در سال 2000، Nesje و همکاران سعی کردند با استفاده از دو جایگاه میکروستلایتی، پرندگانی از قبیل شاهین، باز وحشی، قوش و غیره را تعیین جنسیت نمایند اما این روش در تعیین جنسیت برخی از پرندگان مورد آزمایش موفقیت آمیز نبود (11). همچنین در سال 2004، Agate و همکاران برای تعیین جنسیت Zebra Finches از ژن CHD1-Z و CHD1-W استفاده کردند (12). در این تحقیق با توجه به اینکه توالی ژنهای CHD-W و CHD-Z مربوط به قناری در بانک ژن جهانی ثبت نگردیده اند، لذا همان طور که در بالا اشاره شد، از روی توالی ژن CHD-W مربوط به پرنده ای شبیه به قناری، ترتیب نوکلئوتیدی پرایمرها انتخاب و نتایج مطلوبی در مورد تعیین جنسیت قناری بدست آمد. این سیستم تعیین جنسیت مولکولی بر اساس PCR که برای قناری ماده دو قطعه DNA و برای قناری نر، یک قطعه DNA تکثیر می نماید برای اولین بار تنظیم و معرفی می گردد.

   


نظرات()   
دوشنبه 10 خرداد 1389  09:56 ب.ظ    ویرایش: پنجشنبه 28 مهر 1390 11:03 ق.ظ
توسط: m m
نوع مطلب: بیماریها و درمان ،

به طور کلی قناریها نسبت به سایر پرندگان کمتر دچار بیماری می شوند ، پرنده ای که جای مناسب داشته باشد و به خوبی تغذیه و نگهداری شود ، به ندرت نیازی به دارو و درمان دارد .
مسلما به عنوان یک اصل کلی ، پیشگیری بهتر از درمان میباشد لذا ضروری است که با اهم نکاتی که در پیشگیری از بیماریها اهمیت دارند ، آشنا شویم .
- تیزی و سرزندگی پرنده ، پرهای نرم و مرتب و چشمان شفاف از نشانه های یک پرنده سالم است لذا میباید مراقب هرگونه آشفتگی در پرها و یا بیحالی قناری بود معمولا اختلال در حفظ دمای بدن ، مشکلات تنفسی مانند پخ پخ کردن و بی اشتهایی از نشانه های اولیه بیماری در قناری است . پف کردن قناری ، کاهش وزن و تحلیل رفتن عضلات سینه ، نشاندهنده وخامت بیماری بوده و احتمال از بین رفتن پرنده است.
- در مصرف نادرست داروهای مختلف امکان داردکه عامل بیماری زا دارای مقاومت گشته و دیگر به هیچ آنتی بیوتیکی حساس نباشد .
- درمان ناقص بوسیله مصرف اشتباه داروها ، موجب عدم درمان یا مسمومیت دارویی میشود و احتمال انتقال بیماری به سایرین را فراهم میکند .
- پرنده بیمار را در محل گرم و جدا از سایرین نگهداری کنید .
- اصول و موازین بهداشتی را همواره رعایت کنید و توجه نمایید که برخی بیماریها درمان ندارند .
- پرندگان تازه خریداری شده را به دامپزشک نشان دهید .
- از مدفوع پرندگان تازه خریداری شده تحت نظر دامپزشک آزمایش بعمل آید.
- پرندهای تازه خریداری شده حدود بیست روز یا حداقل یک هفته در قرنطینه نگهداری و با انجام بازرسی صحیح آنها ، تحت کنترل دقیق قرارگیرند .
- عدم دسترسی موش و سایر جوندگان به غذا یا محیط نگهداری قناری و از بین بردن جوندگان .
- مراقبت از قناری و ایجاد آرامش برای جلوگیری از آسیب دیدگی و بروز جراحت در بدن پرنده بخصوص در ناحیه پا ، لازم است سطوح تیز و اشیا برنده در قفس قناری قرار نگیرد . عدم برخورد قناری با دیوار وشیشه درصورت آزاد بودن پرنده درمحل نگهداری .
- ممانعت از تراکم زیاد قناری ها در قفس .
- استفاده از غذاهای مناسب و متنوع و عدم مصرف دانه های مانده و کپک زده و کاهش رطوبت مواد خوراکی .
- استفاده از واکسن آبله و سایر واکسن ها مانند واکسن بیماری نیوکاسل .
- نظافت مداوم قفس قناری بخصوص توجه اساسی به تعویض لانه های ویژه تخم گذاری .
- عدم استفاده خودسرانه و بی رویه از مصرف داروهای مختلف خصوصا در طولانی مدت .
- حفظ رطوبت محیط نگهداری قناری ( توجه شود که محیط نگهداری نه خیلی خشک و نه خیلی مرطوب باشد. )
- هنگام مصرف مواد خوراکی مرطوب مانند میوه ها باقیمانده آنها را از قفس خارج نموده و قفس را نظافت نمایید .
- غذاهای مرطوب مانند میوه جات را قبل از مصرف در یخچال نگهداری کنید .
- حفاظت محیط نگهداری از لحاظ وجود پشه ، کرم خاکی ، سوسک ، کنه و شپش و ضد عفونی محل و انجام سایر اقدامات برای از بین بردن آنها .
- استفاده از توری در اطراف محیط نگهداری به منظور جلوگیری از حضور پشه وسایر حشرات .
- جلوگیری از تماس پرنده با مدفوع گربه و سایر گربه سانان .
- عدم تماس قناری با حیوانات وحشی بخصوص پرندگان وحشی .
- عدم قرار گرفتن طولانی مدت قناری در معرض تابش مستقیم نور خورشید .
- جلو گیری از آسیب دیدگی قناری توسط وسایل گرما زا .
- استفاده از مقادیر کافی ویتامین آ در جیره غذایی برای جلوگیری از کوری قناری .
- جلوگیری از جفت گیری قناریهای هم خانواده .
- توجه به احتمال مسمومیت به لحاظ خوردن رنگ قفس و همچنین روزنامه کف قفس قناری .
- توجه به احتمال مسمومیت قناری بوسیله گاز بخاریهای بدون دود کش .
- توجه به احتمال مسمومیت بوسیله سموم گیاهی یا دامی .
- قرار دادن و در دسترس بودن کف دریا و سنگ ریزه در قفس نگهداری قناری .
- جلوگیری از کمبود ویتامین ها و مواد معدنی درجیره غذایی .
- مصرف بی رویه ویتامین ها بخصوص ویتامین های محلول در چربی شامل ویتامین آ ، د ، ای ، کا می تواند موجب مسمومیت در قناری شود .
- توجه به اثرات نامطلوب تغییر ناگهانی جیره غذایی مانند ایجاد بی اشتهایی یا کم اشتهایی و همچنین بوجود آمدن بیماری یبوست .
- استفاده از سبزی و میوه جات در جیره غذایی قناری .
- عدم مصرف میوه و سبزی در هنگام ابتلا قناری به بیماری اسهال .
- توجه به نور محیط نگهداری برای پیشگیری از پرخوری یا پرکندن قناری .
- استفاده از دانه منداب در جیره غذایی بخصوص برای قناری های ماده .
- استفاده از برنامه غذایی مناسب در هنگام تولک به منظور تامین موادمعدنی و ویتامین های مورد نیاز بدن قناری و پیشگیری از کاهش توان تولید مثل و آوازخوانی .
- کنترل رژیم غذایی قناری در دوران تولک به منظور جلوگیری از چاق شدن پرنده .

   


نظرات()   

قناری

اطلاعاتی در مورد همه ی پرنده های خانگی
این صفحه را در گوگل محبوب کنید